View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_107 (Length: 205)
Name: NF21553_low_107
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 39488594 - 39488737
Alignment:
| Q |
18 |
aaaagtgtagctctagattcacaaaacatggctccacaagcaacaattgaaggtttgtccctagctgagccatcaatattaattttgattccggatggag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39488594 |
aaaagtgtagctctagattcacaaaacatggctccacaagcaacaattgaaggtttgtccctagctgagccatcaatattaattttgatcggggatggag |
39488693 |
T |
 |
| Q |
118 |
ctaaaaaggggaccaaccgaagctacggtactccccaaattttt |
161 |
Q |
| |
|
||| |||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
39488694 |
ctagaaaggggatcaaccgaagctatggtactccccaaaatttt |
39488737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University