View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_23 (Length: 518)
Name: NF21553_low_23
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 17 - 507
Target Start/End: Complemental strand, 44299020 - 44298532
Alignment:
| Q |
17 |
tcttcttctagtaatttagaagctggttctgagacaaaggaaccggaacaaattggtcatggtcatggtc------ttgtggttgcaaatggacatgaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44299020 |
tcttcttctagtaatttagaagctggttctgagacaaaggaaccggaacaaattggtcatggtcatggtcatggtcttgtggttgcaaatggacatgaaa |
44298921 |
T |
 |
| Q |
111 |
agaatgtaaatgctgaacaattgatgcgttaccgtgttgtggctcaggttaatcaatttctttcgtattgttaataagatgatgttgttgttatattaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | | ||||||||||||| |
|
|
| T |
44298920 |
agaatgtaaatgctgaacaattgatgcgttaccgtgttgtggctcaggttaatcaatttctttcgtattgttaa----attttatcattgttatattaat |
44298825 |
T |
 |
| Q |
211 |
taatgtaagttgtgtggaattggattaaggttttggagttaggaattgtggtgcactctgtagtgattggtttgtcattgggtgcttcagagaaccattg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298824 |
taatgtaagttgtgtggaattggattaaggttttggagttaggaattgtggtgcactctgtagtgattggtttgtcattgggtgcttcagagaaccattg |
44298725 |
T |
 |
| Q |
311 |
caccataaggcctctcattgctgcactttgcttccatcaactctttgaaggaatgggtttgggtggttgcatacttcaggtaatgattattaattccatt |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44298724 |
caccataaggcctctcattgctgcactttgcttccatcaactctttgaaggaatgggtttgggtggttgcatacttcaggtaatgatt----attccatt |
44298629 |
T |
 |
| Q |
411 |
taatttcattgaagaatttacaatatgagcaaattattccattaatgtgacaggctgattatggaacgaagatgaaatcgacaatgatattcttctt |
507 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298628 |
taatttcattgaagaatttacaatatgagcaaattattccattaatgtgacaggctgattatggaacgaagatgaaatcgacaatgatattcttctt |
44298532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University