View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_36 (Length: 438)
Name: NF21553_low_36
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_36 |
 | |
|
| [»] scaffold0317 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0317 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 9 - 188
Target Start/End: Original strand, 19448 - 19627
Alignment:
| Q |
9 |
gatttgagcaagaagaaagtgttgggtcggaatcagcactagatgcagcggaatcaacaccgactgcggattggccagagttggtgccgccaggatgatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19448 |
gatttgagcaagaagaaagtgttgggtcggaatcaacaccggatgcggcgaaatcaacaccgactgcggattggccagagttggtgccgccaagatgatg |
19547 |
T |
|
| Q |
109 |
gtggtgatacagcggagcctgatggattctgggggaggggtcgatggtggcattggcatggagagaaagtgagagaggga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19548 |
gtggtgatacagcggagcctgatggattctaggggaggggtcgatggtggcattggcatggagagaaagtgagagaggga |
19627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0317; HSP #2
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 255 - 426
Target Start/End: Original strand, 19638 - 19809
Alignment:
| Q |
255 |
ggattgatggagactatcagggtttcaagaatgagattgaaattcaaattttggggatagggggcgccaaaaaattaggttaagttaagtgggattaggg |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19638 |
ggattgatggagactatcagggtttcaagaatgaatttgaaattaaaattttggggatagggggcgccaaaaaattaggttaagttaagtgggattaggg |
19737 |
T |
|
| Q |
355 |
tttgaatgttagctagctaggattagatataaaagatttgtactaaactctaacccgtgcgatgcacaggtt |
426 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
19738 |
tttggatgttagctagctaggattagatataaaagatatgtactaaactctaacacgtgcgatgcacaggtt |
19809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 42
Target Start/End: Complemental strand, 55877160 - 55877128
Alignment:
| Q |
10 |
atttgagcaagaagaaagtgttgggtcggaatc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55877160 |
atttgagcaagaagaaagtgttgggtcggaatc |
55877128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 43
Target Start/End: Original strand, 26909738 - 26909772
Alignment:
| Q |
9 |
gatttgagcaagaagaaagtgttgggtcggaatca |
43 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
26909738 |
gatttgagcaagaaaaaagtgttgggtcggaatca |
26909772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 11394391 - 11394357
Alignment:
| Q |
9 |
gatttgagcaagaagaaagtgttgggtcggaatca |
43 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11394391 |
gatttgagcaagaagaaagtgttgggttggaatca |
11394357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 43
Target Start/End: Original strand, 32440330 - 32440364
Alignment:
| Q |
9 |
gatttgagcaagaagaaagtgttgggtcggaatca |
43 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32440330 |
gatttgagcaagaagaaagtgttgggttggaatca |
32440364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University