View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_48 (Length: 378)
Name: NF21553_low_48
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_48 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 67 - 378
Target Start/End: Original strand, 43622215 - 43622527
Alignment:
| Q |
67 |
atatacagaaatcgatttaattattcaaacagttatgaacactttaaatattgtgtgcattccttttaggatatcttgtttatccaattagatttaatta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43622215 |
atatacagaaatcgatttaattattcaaacagttatgaacactttaaatattgtgtgcattccttttaggatatcttgtttatccaattagatttaatta |
43622314 |
T |
|
| Q |
167 |
ttcaaataactatgaacactgccattcaaaacaaaaatattggcttgcccaaannnnnnnnaa-ttatattttcacctaattcataccaaataaccaacc |
265 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43622315 |
ttcaaataactgtgaacactgccattcaaaacaaaagtattggcttgcccaaattttttttaatttatattttcacctaattcatacccaataaccaacc |
43622414 |
T |
|
| Q |
266 |
accggctctttacttannnnnnngagaggtgatctttacttatttgccacttcaccttgttgcaataaagttttcgtcttctttctcctgcaatctcttt |
365 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43622415 |
accggctctttacttatttttttgagaggtgatctttacttatttgccacttcaccttgtcgcaataaagttttcgtcttctttctcctgcaatctcttt |
43622514 |
T |
|
| Q |
366 |
tcagatatatact |
378 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43622515 |
tcagatatatact |
43622527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University