View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_58 (Length: 335)
Name: NF21553_low_58
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 7837508 - 7837257
Alignment:
| Q |
1 |
gtgttggaagattaaggtgaccgttgttgttgctatgatgataattaggaacatgctgaaaatgttgttgaggaatactatgttgttgttggacatgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837508 |
gtgttggaagattaaggtgaccgttgttgttgctatgatgataattaggaacatgctgaacatgttgttgaggaatactatgttgttgttggacatgttt |
7837409 |
T |
|
| Q |
101 |
tcgatggaaattacggtgacaatcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctaccacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837408 |
tcgatggaaattacggtgacaatcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctaccacg |
7837309 |
T |
|
| Q |
201 |
tggcttcccatgcttgccgcgtggtttctcagacattctcggtaacatattt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837308 |
tggcttcccatgcttgccgcgtggtttctcagacattctcggtaacatattt |
7837257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University