View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_84 (Length: 266)
Name: NF21553_low_84
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 6916332 - 6916580
Alignment:
| Q |
1 |
tagggtcttgagctaacaatatactcaaacctaaccaattatgacatccatttctgccgacaacccaagacttcaaacaccaattttagctcattaatca |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916332 |
taggatcttgagctaacaatatactcaaagctaactaattatgacatccatttctgccgacaacccaagacttcaaacaccaattttagctcattaatca |
6916431 |
T |
 |
| Q |
101 |
aactccataattacattcacaaacaaaatcagaagatgaatcttttcaataatcacattaacacaaacagttcaagtctcacactctgagtgtgccatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916432 |
aactccataattacattcacaaacaaaatcagaagatgaatcttttcaataatcacattaacacaaacagttcaagtctcacactctgagtgtgccatgc |
6916531 |
T |
 |
| Q |
201 |
caagtagtagcaacataaagcgcacactgttattaacaattcgtgtttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916532 |
caagtagtagcaacataaagcgcacactgttattaacaattcgtgtttc |
6916580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 122
Target Start/End: Original strand, 6916012 - 6916075
Alignment:
| Q |
59 |
gacaacccaagacttcaaacaccaattttagctcattaatcaaactccataattacattcacaa |
122 |
Q |
| |
|
|||||| ||| ||||||||||||||||| ||| ||||||| |||||||||||| | |||||||| |
|
|
| T |
6916012 |
gacaacacaatacttcaaacaccaatttcagcccattaattaaactccataatcagattcacaa |
6916075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University