View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_87 (Length: 257)
Name: NF21553_low_87
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_87 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 9 - 257
Target Start/End: Complemental strand, 42524394 - 42524150
Alignment:
| Q |
9 |
gagaagaatggatatgattcgtccagttgtggtcagagctgaaatgtttggtcagttaactactggtcttgaatctgcctggaacaaactcaaaggagaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42524394 |
gagaagaatggatatgattcgtccagttgtggtcagagctgaaatgtttggtcagttaactactggtcttgaatctgcctggaacaaactcaaaggagaa |
42524295 |
T |
 |
| Q |
109 |
ggtttttccttcctttctctttttcaattcaactataattacttacttactttgcaacttccactctcacacggagactataccaatgatcattaatcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
42524294 |
ggtttttccttcctttctctttttcaattcaactataattactt----actttgcaacttccactctcacacggagacgatactaatgatcattaatcaa |
42524199 |
T |
 |
| Q |
209 |
tttataagtaattgaatttaattacatgtatttgtattgttggacaccc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42524198 |
tttataagtaattgaatttaattacatgtattggtattgttggacaccc |
42524150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University