View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_96 (Length: 239)
Name: NF21553_low_96
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_96 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 3567259 - 3567479
Alignment:
| Q |
19 |
gatagagatgacggcggaaaagtgataactgaagtcattggcacatgtttgattggtaggttggattggcggctctggtctctatgtcgttagttcggac |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
3567259 |
gatagagatgatggcggaaaagtgataactgaagtcattggcacatgtttgattggtaggctgaattggcggctctggtctctatgtcattagttcagac |
3567358 |
T |
 |
| Q |
119 |
tcgattatcatcttctcagaatgctatactcgcttcacagaatgttactgcatcggcacaatttattacggtgcctcaaaaatcatttggggttgtgtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3567359 |
tcgattatcatcttctcagaatgctatactcgcttcacagaatgttactgcatcggcacaatttattacggtgcctcaaaaatcatttggggttgtgtta |
3567458 |
T |
 |
| Q |
219 |
gggtgcagcaatccatcgcac |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3567459 |
gggtgcagcaatccatcgcac |
3567479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University