View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_97 (Length: 239)
Name: NF21553_low_97
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_97 |
 | |
|
| [»] scaffold1019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 73 - 226
Target Start/End: Complemental strand, 32490007 - 32489854
Alignment:
| Q |
73 |
atgatactttctacaattggattgatgttattcttaaatcagcatttctctctatttatgtgaatgagaaagctcaaggatatttccaatgcactagagg |
172 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32490007 |
atgatactctctacaattggattgatgttattcttaaatcagcatttctctctatttatgtgaatgagaaagctcaaggatatttccaatgcactaaagg |
32489908 |
T |
|
| Q |
173 |
tgtaaggtttaataataagataatctcttggaagtcagccatttctagtataat |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32489907 |
tgtaaggttcaataataagataatctcttggaagtcagccatttctagtataat |
32489854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 32490051 - 32490008
Alignment:
| Q |
1 |
ctcttgcacaacaaagtctttgacacactagagtgaccattttt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490051 |
ctcttgcacaacaaagtctttgacacactagagtgaccattttt |
32490008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1019 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1019
Description:
Target: scaffold1019; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 767 - 702
Alignment:
| Q |
63 |
tttggtttgaatgatactttctacaattggattgatgttattcttaaatcagcatttctctctatt |
128 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||| ||||| || ||||| |||||||||||| |
|
|
| T |
767 |
tttggtttcaatgatgttttctgtaattggattgatgtgattctaaagtcagcctttctctctatt |
702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University