View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21553_low_99 (Length: 238)
Name: NF21553_low_99
Description: NF21553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21553_low_99 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] scaffold0117 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 495923 - 496139
Alignment:
| Q |
22 |
tagggtttgtagtttgaacaatgcatatcaatgttcttgaaactatctatcaacactataggagtctagttttggatagaaataaagttctcaatatatt |
121 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
495923 |
tagggtttgtagtttgaaccatgcatgtcaatgttcttgaaactatctatcaacactataggagtctagttttggatagaaataaagttctcaatatatt |
496022 |
T |
|
| Q |
122 |
tagatgtattgactgaaatattttcacattaaatcctatactacaaatacgcaagtgcaagattttttctgccgcgaaccaatttgtgacagtcctttcg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
496023 |
tagatgtattgactgaaatattttcacattaaatcctatactactaatacgcaagtgcaagattttttctgccgcgaaccgatttgtgacagtcctttcg |
496122 |
T |
|
| Q |
222 |
tgtaccatgatcaccac |
238 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
496123 |
tgtactatgatcaccac |
496139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 888323 - 888394
Alignment:
| Q |
163 |
tacaaatacgcaagtgcaagattttttctgccgcgaaccaatttgtgacagtcctttcgtgtaccatgatca |
234 |
Q |
| |
|
|||||||||||| | ||| || |||||||| | |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
888323 |
tacaaatacgcaggcgcaggaatttttctgacatgaaccaatttgtgacagtcctttcttgtaccatgatca |
888394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 16465 - 16412
Alignment:
| Q |
181 |
agattttttctgccgcgaaccaatttgtgacagtcctttcgtgtaccatgatca |
234 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16465 |
agattatttctgccatgaaccaatttgtgacagtcctttcttgtaccatgatca |
16412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University