View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21554_high_11 (Length: 304)
Name: NF21554_high_11
Description: NF21554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21554_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 33488805 - 33488993
Alignment:
| Q |
20 |
tcctcatctttcaacgattttctctcagcagcagaagcacatgaagaagtggaagaagagggaggatatgcagctaataaagctgtagcattccactcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33488805 |
tcctcatctttcaacgattttctctcagcagcagaagcacatgaagaagtggaagaagagggaggatatgcagctaataaagctgtagcattccactcat |
33488904 |
T |
 |
| Q |
120 |
ggttcctaacaagttctgaaaatagaagtatcagtgaagccatattgcaattcaaaaatttcaagagatttgtatatagtagttgatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33488905 |
ggttcctaacaagttctgaaaatagaagtatcagtgaagccatattgcaattcaaaaatttcaagagatttgtatatagtagttgatgt |
33488993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University