View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21554_low_13 (Length: 270)
Name: NF21554_low_13
Description: NF21554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21554_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 49 - 270
Target Start/End: Complemental strand, 24200064 - 24199843
Alignment:
| Q |
49 |
acactacattgcctaaatgctctccatgttgtataattcaagtataaaaatttaagtgaattgtggatgcattcagtcatctttacctctgaaagcaata |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24200064 |
acactacattgcctaaatgctctccatgttgtataattcaagtataaaaatttaagtgaatcgtggaagcattcagtcatctttacctctgaaagcaata |
24199965 |
T |
|
| Q |
149 |
attatgatgtttcatgcaatatttcttcaacgaatggcccaacatctgcagaggagatcgagaatgagcattgctaactggttttccctttgaaactgtc |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||| || |
|
|
| T |
24199964 |
attatgatgtttcatgcaatgtttcttcaacgaatggcccaacatctgcagaggagattgagaatgagcattgctaactggttttgcctttgtaactttc |
24199865 |
T |
|
| Q |
249 |
ttactaacatcagattttatca |
270 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24199864 |
ttactaacatcagattttatca |
24199843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 130 - 179
Target Start/End: Complemental strand, 32678489 - 32678440
Alignment:
| Q |
130 |
tttacctctgaaagcaataattatgatgtttcatgcaatatttcttcaac |
179 |
Q |
| |
|
||||||||||||||||| | || |||||||| ||||||||| |||||||| |
|
|
| T |
32678489 |
tttacctctgaaagcaaaatttttgatgttttatgcaatatctcttcaac |
32678440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University