View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21554_low_20 (Length: 216)
Name: NF21554_low_20
Description: NF21554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21554_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 40224460 - 40224274
Alignment:
| Q |
12 |
agattattctgttacaggtgaaactcaattattttaattaagattgtgattggttttctttgagtttggtttcattttacgtttttcgtgttgaaattga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224460 |
agattattctgttacaggtgaaactcaattattttaattaagattgtgattggttttctttgagtttggtttcattttacgtttttcgtgttgaaattga |
40224361 |
T |
 |
| Q |
112 |
gacattattttgtttaatctttgtgggactcactcagggtctgcgacagaaacaagaaagagttgctcagaccaagatagttacatc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224360 |
gacattattttgtttaatctttgtgggactcactcagggtctgcgacagaaacaagaaagagttgctcagaccaagatagttacatc |
40224274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University