View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21555_high_3 (Length: 247)
Name: NF21555_high_3
Description: NF21555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21555_high_3 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 33881451 - 33881683
Alignment:
| Q |
15 |
atccggtgtgttgattgtgtctgcttcaagttgtcaatggctcaactcaaatcgaagtcttggtaaagaatcaatttggtcactcaaattagacactcaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33881451 |
atccggtgtgttgattgtgtctgcttcaagttgtcaacggctcaactcaaatcgaagtcttggtaaagaatcaatttggtcactcaaattagacactcaa |
33881550 |
T |
 |
| Q |
115 |
attagaccaaattggaaaaataggtttcagtgacagtgacaggttagcatgaatgagcatcagatcatgctatttcaacaagagtttaattaccaatatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33881551 |
attagaccaaattggaaaaataggtttcagtgacagtgacaggttagcatgaatgagcatcagatcatgctatttcaacaagagtttaattaccaatatc |
33881650 |
T |
 |
| Q |
215 |
tttgcttatttcaacaatgttatttgtctgtgc |
247 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
33881651 |
tttgattatttcaacaatgttatttgtctgtgc |
33881683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 29 - 112
Target Start/End: Complemental strand, 43623297 - 43623214
Alignment:
| Q |
29 |
ttgtgtctgcttcaagttgtcaatggctcaactcaaatcgaagtcttggtaaagaatcaatttggtcactcaaattagacactc |
112 |
Q |
| |
|
||||||||||||||||||||| | | |||||| |||| | |||||||| ||||||||||||||||| |||||||||| ||||| |
|
|
| T |
43623297 |
ttgtgtctgcttcaagttgtcgacgactcaacccaaaccaaagtcttgtaaaagaatcaatttggtcgctcaaattaggcactc |
43623214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 112
Target Start/End: Complemental strand, 8645417 - 8645374
Alignment:
| Q |
69 |
aagtcttggtaaagaatcaatttggtcactcaaattagacactc |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8645417 |
aagtcttggtaaataatcaatttggtcactcaaattaggcactc |
8645374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University