View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21556_high_6 (Length: 251)
Name: NF21556_high_6
Description: NF21556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21556_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 86 - 246
Target Start/End: Original strand, 428756 - 428917
Alignment:
| Q |
86 |
taaggaaataaaaaattaaaatggaatcgtgaaatttcttatcaaccaaaa-aatcataagcatcgtttcagggaatagtgaatagacattaatagtgag |
184 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428756 |
taaggaaataaaaaaataaaatggaatcgtgaaatttcttatcaaccaaaaaaatcataagcatcgtttcagggaatagtgaatagacattaatagtgag |
428855 |
T |
 |
| Q |
185 |
gaacttgcttccttattttgtgatttcagatctttgaaccattatccttttcctttgcttct |
246 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
428856 |
gaacttacttccttattttgtgatttcagatctttgaaccattatccttttcctttgtttct |
428917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 172 - 246
Target Start/End: Complemental strand, 30640674 - 30640600
Alignment:
| Q |
172 |
cattaatagtgaggaacttgcttccttattttgtgatttcagatctttgaaccattatccttttcctttgcttct |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30640674 |
cattaatagtgaggaacttacttccttattttgtgatttcagatctttgaaccattatccttttcctttgtttct |
30640600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University