View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21556_low_9 (Length: 239)
Name: NF21556_low_9
Description: NF21556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21556_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 26 - 232
Target Start/End: Original strand, 428378 - 428584
Alignment:
| Q |
26 |
caaaagccaatgcaagatgataaccaagtcaagagaagagtaaaaggtcggtgtttataggttagatgattatggcattgtaatttgtaggttattttac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428378 |
caaaagccaatgcaagatgataaccaagtcaagagaagagtaaaaggtcggtgtttataggttagatgattatggcattgtaatttgtaggttattttac |
428477 |
T |
 |
| Q |
126 |
attatgacataacaagttgttaattgaaatgattgtgttcttggtaatgattaattgttgaaaagttgactcctaaaccacaagaaccctacaatagagg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
428478 |
attatgacataacaagttgttaattgaaatgattgtgttcttggtaatgattaattgttgaaaagttgactcctaaaccacaagaactctacaatagagg |
428577 |
T |
 |
| Q |
226 |
caaagtc |
232 |
Q |
| |
|
||||||| |
|
|
| T |
428578 |
caaagtc |
428584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University