View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21557_high_9 (Length: 363)
Name: NF21557_high_9
Description: NF21557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21557_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 4891515 - 4891701
Alignment:
| Q |
15 |
agatgaagaacttgccatctcgcagaatcaaaaaccctagcgagatggaccgagagcacgcaaaattgaaaacctaatcaattatcctggttatggatac |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891515 |
agatgaagaacttgccatctcgcggaatcaaaaaccctagcgagatggaccga-----cgcaaaattgaaaacctaatcaattatcctggttatggatac |
4891609 |
T |
 |
| Q |
115 |
agctgtcagaaatggattgttctctttgtctggatcgggaatgaatgaatgctttgttgcaattgcaatttcatatacacaaaaagggaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891610 |
agctgtcagaaatggattgttctctttgtctggatcgggaatgaatgaatgctttgttgcaattgcaatttcatatacacaaaaagggaaaa |
4891701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 239 - 344
Target Start/End: Original strand, 4891738 - 4891843
Alignment:
| Q |
239 |
ttaatattttacggtgtgagtgaaaccactaacaaaacaacgatgtggatggaagatgagtgattatatgttttttctgtaatctctttcattattgttg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891738 |
ttaatattttacggtgtgagtgaaaccactaacaaaacaacgatgtggatggaagatgagtgattatatgttttttctgtaatctctttcattattgttg |
4891837 |
T |
 |
| Q |
339 |
ttgctg |
344 |
Q |
| |
|
|||||| |
|
|
| T |
4891838 |
ttgctg |
4891843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 113 - 206
Target Start/End: Complemental strand, 440137 - 440042
Alignment:
| Q |
113 |
acagctgtcagaaatggattgttctctttgtctggatcgggaatgaatgaatgctttgttgcaattgcaatttcatatacac--aaaaagggaaaa |
206 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
440137 |
acagctgtcagaattggtttgttctctttctctggatcgggaatgaatcaatgttttgttgcaattgcaatttcatatacacagaaaaagggaaaa |
440042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 244 - 302
Target Start/End: Complemental strand, 440026 - 439968
Alignment:
| Q |
244 |
attttacggtgtgagtgaaaccactaacaaaacaacgatgtggatggaagatgagtgat |
302 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
440026 |
attttacagtgtgagtgagatcactaacaaaacaacgatgtggatagaagatgagtgat |
439968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 440237 - 440183
Alignment:
| Q |
15 |
agatgaagaacttgccatctcgcagaatcaaaaaccctagcgagatggaccgaga |
69 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
440237 |
agatgaagaactcgccatctcgcggaatcaaaaaccctagcgagatggatcgaga |
440183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University