View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21558_low_9 (Length: 207)
Name: NF21558_low_9
Description: NF21558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21558_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 87 - 185
Target Start/End: Complemental strand, 33500723 - 33500625
Alignment:
| Q |
87 |
catcttagagggactgatttgtttcttgtttcttctaaatagaatgactttatgtgcttgtggacaactttgaaaatcctcaaccactgaactaaggtt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33500723 |
catcttagagggactgatttgtttcttgtttcttctaaatagaatgactttatgtgcttgtggacaactttgaaaatcctcaaccactgaactaaggtt |
33500625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University