View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21559_high_12 (Length: 213)
Name: NF21559_high_12
Description: NF21559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21559_high_12 |
 | |
|
| [»] scaffold0044 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0044 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 5271 - 5059
Alignment:
| Q |
1 |
caatgggacatgtagcaattattaaagcaacaatcacatgggataactcgggtggtgagtgaacatagatttacaggaataaagaaaaagaaccaatact |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
5271 |
caatgggacatgtagcaattatgaaagcaacaatcacatgggataactcgggtggtgagtgaacatcgatttaccggaataaagaaaaagaaccaatact |
5172 |
T |
|
| Q |
101 |
aggataattattcactatgattgaaatttatgagaacccaaaaacactcacgtaagaggtattccaaaaccaaaagaaaacaacttatgtatgaggtaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5171 |
aggataattattcactatgattgaaatttatgagaacccaaaaacactcacgtaagaggtattccaaaaccaaaagaaaacaacttatgtatgaggtaac |
5072 |
T |
|
| Q |
201 |
caattggaatcta |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5071 |
caattggaatcta |
5059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University