View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21560_low_17 (Length: 328)
Name: NF21560_low_17
Description: NF21560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21560_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 5217506 - 5217261
Alignment:
| Q |
13 |
aatatcccatacttgtttgcactatcaacctgtatatattgtcggcaacattcaatacaattctcattataattaaataaatgttactctttttcataag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5217506 |
aatatcccatacttgtttgcactatcaacctgtatatattgtcggcaacattcaagaccattctcattataattaaataaatgttactctttttcataag |
5217407 |
T |
|
| Q |
113 |
aaaagtcaaaatgctttggttactagtaacttatggttactaacttctttagcaacnnnnnnnnnnnnnnatgatagaaaaacccataatatattatgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
5217406 |
aaaagtcaaaatgctttggttactagtaacttatggttactaacttctttagcaac-tttttttttttttatgatagaaaaacccataatatattacgtc |
5217308 |
T |
|
| Q |
213 |
ataacactgacatttctaatgaaaaacgtctttggtgtccaccgctt |
259 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
5217307 |
ataacactaacatttctgttgaaaaacgtctttggtgtccaacgctt |
5217261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University