View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21560_low_19 (Length: 316)
Name: NF21560_low_19
Description: NF21560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21560_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 120 - 312
Target Start/End: Complemental strand, 32145035 - 32144844
Alignment:
| Q |
120 |
aagttcaattttaactttcaaattgatagtgaatgaatacttgactagtttgtttaaaaattgttacgatgaaatttagtttttaacatgacatgaaacg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32145035 |
aagttcaattttaactttcaaattgatagtgaatgaatacttgactagtttgtttaaaaattgttacgatgaaatttagtttt-aacatgacatgaaacg |
32144937 |
T |
 |
| Q |
220 |
agggcaaaatttgtcttcaccgaaaacaataaattgcgacttaacatgcttctctagagaaataacatacaatttgtctttacatagttagca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32144936 |
agggcaaaatttgtcttcaccgaaaacaataaattgtgacttaacatgcttctctagagaaataacacacaatttgtctttacatagttagca |
32144844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 32146236 - 32146147
Alignment:
| Q |
17 |
cataaacaaatagcatacaatataataataa---caatcttgtttaagaccaaaatcaataatatgcaaaataatgccaaaattaagata |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32146236 |
cataaacaaatagcatacaatataataataataacaatcttgtttaagaccaaaatcaataatatgcaaaataatgccaaaattaagata |
32146147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University