View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21560_low_26 (Length: 228)
Name: NF21560_low_26
Description: NF21560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21560_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 50 - 212
Target Start/End: Complemental strand, 34473510 - 34473348
Alignment:
| Q |
50 |
aaaggtagtgtggttgaggaggttgaggatcagttggagtatttctttaatggtgttggtcaagggatacagattcagcttgttagtgaactcatagacc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34473510 |
aaaggtagtgtggttgaggaggttgaggatcagttggagtatttctttaatggtgttggtcaagggatacagattcagcttgttagtgaactcatagacc |
34473411 |
T |
|
| Q |
150 |
ctggtttgtttcttccaaatattatactatttattttctctattcttctataattcagttcat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34473410 |
ctggtttgtttcttccaaatattatactatttattttctctattcttctataattcagttcat |
34473348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University