View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21560_low_29 (Length: 215)
Name: NF21560_low_29
Description: NF21560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21560_low_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 6 - 215
Target Start/End: Original strand, 33260527 - 33260745
Alignment:
| Q |
6 |
cgtagtggcacctctgagttatcaaaacttaatattctccataaaattttgaattagaaaatcgattgattccaaggcgaggggccaattgagtctctta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33260527 |
cgtagtggcacctctgagttatcaaaacttaatattctccataaaattttgaattagaaaattgattgattccaaggcgagcggccaattgagtctctta |
33260626 |
T |
 |
| Q |
106 |
ccggtggaccacgaaaaaatcatcacattctatctagcccttacccatctctcttactgtgta-----cgaa----aaatggtactgcaatgatgaattt |
196 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
33260627 |
ccggtgaaccacgaaaaaaacatcacattctatctagcccttatccatctctcttactgtgtaactgccttattttaaatggtactgcaatgatgaattt |
33260726 |
T |
 |
| Q |
197 |
taccaagtccatatcttct |
215 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33260727 |
taccaagtccatatcttct |
33260745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 168
Target Start/End: Complemental strand, 8114153 - 8114114
Alignment:
| Q |
129 |
cacattctatctagcccttacccatctctcttactgtgta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8114153 |
cacattctatctagcccttacccatctctcttaccgtgta |
8114114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 168
Target Start/End: Complemental strand, 41419545 - 41419506
Alignment:
| Q |
129 |
cacattctatctagcccttacccatctctcttactgtgta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41419545 |
cacattctatctagcccttacccatctctcttaccgtgta |
41419506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 208
Target Start/End: Complemental strand, 44377375 - 44377340
Alignment:
| Q |
173 |
aaatggtactgcaatgatgaattttaccaagtccat |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44377375 |
aaatggtactccaatgatgaattttaccaagtccat |
44377340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University