View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21560_low_30 (Length: 210)
Name: NF21560_low_30
Description: NF21560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21560_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 42771446 - 42771268
Alignment:
| Q |
14 |
caaagggttcattgtggagcaaatccaaaggagaagatatcattattggaaatttagacactggtaattaatttagaatttatttattctttcatttgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42771446 |
caaagggttcattgtggagcaaatccaaaggagaagatatcattattgggaatttagacactggtaattaattttgaatttatttattctttcatttgaa |
42771347 |
T |
 |
| Q |
114 |
tgcaatgtgccttatgagacatgatttgaaccatttgatagatgnnnnnnnngacaaattaaaaccatttgatagatgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42771346 |
tgcaatgtgccttatgagacatgatttgaaccatttgatagatgttttttttgacaaattaaaaccatttgatagatgt |
42771268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University