View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21561_low_5 (Length: 280)
Name: NF21561_low_5
Description: NF21561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21561_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 12921672 - 12921926
Alignment:
| Q |
1 |
ctgcaaacataagaaggccaattccatgtcttctaatttctcttttttgattatggtgaattggctggatctaactgacctaaatttgnnnnnnnnngag |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12921672 |
ctgcaaacataagaaggccaattccatttcttctaatttctcttttttgattatggtgaattggctggatctaactgacctaaatttgtttttttttgag |
12921771 |
T |
|
| Q |
101 |
ggattaattttatttttatatagcaaaaatcttcacttctgatttccatatcaagaaaccgtatgttgcaaacagagacattgcgcagagtttgcctctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12921772 |
ggattaattttatttttatatagcaaaaatcttcacttctgatttccatatcaagaaaccgtgtgttgcaaacagagacattgcgcagagtttgcctctt |
12921871 |
T |
|
| Q |
201 |
tgggaagtgacataacatacactgaataccaaaaat-aaaaagcattaaatgaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12921872 |
tgggaagtgacataacatacactgaataccaaaaataaaaaagcattaaatgaat |
12921926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University