View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_high_41 (Length: 260)
Name: NF21562_high_41
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 55379381 - 55379606
Alignment:
| Q |
19 |
aaatatatcatcttagtagcaacagcatgtcaacccccaaacaatgtgcaatatgtgttctttccaaaagcaactttactagtggaagaagcctctaggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55379381 |
aaatatatcatcttagtagcaacagcatgtcaacccccaaacaatgtgcaatatgtgttctttccaaaagcaactttactagtggaagaagcctctaggt |
55379480 |
T |
 |
| Q |
119 |
cagtcttggttgtcaacgcgttgccttttccggcacctgccacaaaatctaacaatgctgctattcaagacttcatatcttaaaaataacaatacggtca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55379481 |
cagtcttggttgtcaacgcgttgccttttccggcacctgccacaaaatctaacaatgctgctattcaagacttcatatcttaaaaataacaatacggtca |
55379580 |
T |
 |
| Q |
219 |
gctaaatcaaacaatagtgtcaattc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
55379581 |
gctaaatcaaacaatagtgtcaattc |
55379606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 18907990 - 18907962
Alignment:
| Q |
1 |
tatgtttttggtccctataaatatatcat |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18907990 |
tatgtttttggtccctataaatatatcat |
18907962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University