View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_high_46 (Length: 248)
Name: NF21562_high_46
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 43394407 - 43394596
Alignment:
| Q |
14 |
agcagcagagaaaccccttttagcaccagataccaaactcttaagcacaccaccattttctctctctggtgactcagagcctggtaaccctaacctcagt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43394407 |
agcatcagagaaaccccttttagcaccagataccaaactcttaagcacaccaccattttctctctctggtgactcagagcctggtaaccctaaccttagt |
43394506 |
T |
|
| Q |
114 |
tcagtagctttgaggttcaaaccaatgcttctctctttggtttccattgaaggaacctctccataaccttgttccactggcacagacatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43394507 |
tcagtagctttgaggttcaaaccaatgcttctctctttggtttccattgaaggaacctctccataaccttgttccactggcacagacatc |
43394596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University