View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_high_49 (Length: 239)
Name: NF21562_high_49
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 33 - 237
Target Start/End: Original strand, 30287487 - 30287692
Alignment:
| Q |
33 |
attatgtttagagtcgaatttgatgtcgtgacaatattctatctaagtgtcacaaaggactcagtttgcaatttgatggactgattgtactaataa-ttg |
131 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||| |
|
|
| T |
30287487 |
attatgtttagagttgaatttgatgttctgacaatattttatccaagtgtcacaaaggactcagtttgcaatttgatggactgattgtcctactaaattg |
30287586 |
T |
 |
| Q |
132 |
atacagattaaggctgccattgcagttattcgcaatattcgtggtttacccccagcccaagatttcaagaaacatggagcctttgttgatctgtttgata |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30287587 |
atacagattaaggctgccattgcagttattcgcaatattcgaggtttacccccagcccaagatttcaagaaacatggagcctttgttgatctgtttgatt |
30287686 |
T |
 |
| Q |
232 |
ttcttc |
237 |
Q |
| |
|
|||||| |
|
|
| T |
30287687 |
ttcttc |
30287692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University