View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_high_54 (Length: 229)
Name: NF21562_high_54
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 41026565 - 41026775
Alignment:
| Q |
1 |
agaatcaacctcactgacagtgagctcacacgtctgacatgtgaaattcttactcatataatctcttgacggaggagtccatgtgggatgatcaggaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41026565 |
agaatcaacctcactgacagtgagctcacacgtctgacatgtgaaattcttactcatataatctcttgacggaggagtccatgtgggatgatcaggaagc |
41026664 |
T |
 |
| Q |
101 |
tttggtattaacaacttctggacaacctttgcaatatcagagtgactaggtatcaaaggaggccgaaccatattcccaccctgcaacggctggtgcatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41026665 |
tttggtattaacaacttctggacaacctttgcaatatcagagtgactaggtatcaaaggaggccgaaccatattcccaccctgcaacggctggtgcatag |
41026764 |
T |
 |
| Q |
201 |
cagacatattt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
41026765 |
cagacatattt |
41026775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University