View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_high_59 (Length: 202)
Name: NF21562_high_59
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_high_59 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 25 - 202
Target Start/End: Original strand, 41026187 - 41026364
Alignment:
| Q |
25 |
agatgaaatgttggaaccttgtatatctctcgtatctggggtatttgagtcaaatgatggctcagtattgtgattggtactggaatcagttggaacagag |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41026187 |
agatgaaatgttggaaccttgtatatctctcgtatctggggtatttgagtcaaatgacggctcagtattgtgattggtactggaatcagttggaacagag |
41026286 |
T |
 |
| Q |
125 |
tttccattttttgttaacatatgtgggctgaccttcggatctaagttatctggtttcttctctgaagctggttgaata |
202 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41026287 |
tttccatttgttgttaacatctgtgggctgaccttcggatctaagttatctggtttcttctctgaagatggttgaata |
41026364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 13139834 - 13139874
Alignment:
| Q |
1 |
ttttgcttgctccgcagggttttcagatgaaatgttggaac |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
13139834 |
ttttgcttgctccgcagggttttccgatgaaatgctggaac |
13139874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University