View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_low_16 (Length: 463)
Name: NF21562_low_16
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 19 - 456
Target Start/End: Original strand, 21144615 - 21145052
Alignment:
| Q |
19 |
tttagggagatgaaggaatggaatccaagcttagtggccagcaaaataactgtttggattaaaatcctaagtttaccagttcatgtctgggatgaagagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144615 |
tttagggagatgaaggaatggaatccaagcttagtggccagcaaaagaactgtttggattaaaatcctaagtttaccagttcatgtctgggatgaagagg |
21144714 |
T |
 |
| Q |
119 |
ctttcaagcagattggagaccaatttggtgagttcttggattttgatgaggatacaattttacggaggatattggatgtggctagaataaaaatctacac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21144715 |
ctttcaagcagattggagaccaatttggtgagttcttggattttgatgaggatacaattttaaggaggatattggatgtggctagaatcaaaatctacac |
21144814 |
T |
 |
| Q |
219 |
tattggttggataataggcaaatcaaagaggtggttgaggaggtgtggaattcacaacatttaacgtgatggatgggatttgtgttaaaagagaaactaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21144815 |
tattggttggataataggcaaatcaaagaggtggttgaggaggtgtggaattcacaacatttaacgtgatggatgggatttctgttaaaagagaaactaa |
21144914 |
T |
 |
| Q |
319 |
aaggggttaaaggaaggcttagagagtggaacaaggaggagcatggttcgatgtaagagagaatttctaggttaaaagaagatgtacaagaggtggattt |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21144915 |
aaggggttaaaggaaggcttagagagtggaacaaggaggagtatggttcgatgtaagagagaatttctaggttaaaagaagatatacaagaggtggattt |
21145014 |
T |
 |
| Q |
419 |
aaggggagagttgtcgttgttgagtgatgatgatgtcc |
456 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
21145015 |
aaggggagagttgtcgttgttgaatgatgaagatgtcc |
21145052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University