View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_low_51 (Length: 239)
Name: NF21562_low_51
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_low_51 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 14854214 - 14854453
Alignment:
| Q |
2 |
aaagggcgtagtttaggtggtatatgcggttaataatcatgaaatgcatagcttccctgttgtaatgtcccttatatatattgattgaactttgtgagga |
101 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
14854214 |
aaaggacgtagtttaggtggtatatgcagttaataatcatgaaatgcatagcttccctattgtaatgtcctttatatatattgattgaacttagtgagga |
14854313 |
T |
 |
| Q |
102 |
tttgatatgtaaccactttttgattctatccttaaacacgtagatatcacaaag-aacatgataccaacaatttcc-nnnnnnnctaggataccattgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
14854314 |
tttgatatgtaaccactttttgattctatccttaaacacgtagatctcacaaagaaacatgatgccaaaaatttccaaagaaaactaggataccattgat |
14854413 |
T |
 |
| Q |
200 |
aattcattaccacacatgacagacttcagacgttgacaaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854414 |
aattcattaccacacatgacagacttcagacgttgacaaa |
14854453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University