View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21562_low_53 (Length: 238)

Name: NF21562_low_53
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21562_low_53
NF21562_low_53
[»] chr8 (1 HSPs)
chr8 (130-205)||(14854656-14854731)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 130 - 205
Target Start/End: Original strand, 14854656 - 14854731
Alignment:
130 tcgatccgattgaggacaaacgatcgaaaaacaccagctcccacaaaaggccag-aaagaggatagggaccttagga 205  Q
    |||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||    
14854656 tcgatccgattgaggacaaacgatcg-aaaacacaagctcccacaaaaggccagaaaagaggatagggaccttagga 14854731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University