View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21562_low_59 (Length: 210)
Name: NF21562_low_59
Description: NF21562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21562_low_59 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 41127204 - 41127030
Alignment:
| Q |
20 |
aaattcactaccgcatttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctca |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41127204 |
aaattcactaccacatttttaggcagcaagtaaccgtcgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacacctca |
41127105 |
T |
|
| Q |
120 |
gcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctctttaatttccttattctcttcat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127104 |
gcccttccaaaatcacacactttagatatggtaggttctgcaagtcttcctctttaatttccttattctcttcat |
41127030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 33 - 174
Target Start/End: Complemental strand, 2303609 - 2303468
Alignment:
| Q |
33 |
catttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaat |
132 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||||||||||| |||||||| || ||||||| ||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2303609 |
catttttaggcaccaaataaccgttcaaaaccacatcctctttcaccgcgtgtggcaacagaaaatgccccggtggatgacgcctcaacccttccaaaac |
2303510 |
T |
|
| Q |
133 |
cacacactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
||||| || | ||| | || |||||||| ||||||||||| |
|
|
| T |
2303509 |
aacacatttcaaataccgaagtttctgcaattcttcctcttt |
2303468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 35 - 174
Target Start/End: Complemental strand, 2293994 - 2293855
Alignment:
| Q |
35 |
tttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaatca |
134 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||| |||||||| || |||||| ||| | ||||||||| |||||||||| ||||||||||| || |
|
|
| T |
2293994 |
tttttaggcaccaaataaccgtccaaaaccacatcctctttcaccgcgtgtggcaacggaaatttccccggtggatgacgcctcaacccttccaaaacca |
2293895 |
T |
|
| Q |
135 |
cacactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
||||||| | ||| | || |||||||||||||||||||| |
|
|
| T |
2293894 |
cacacttcaaataccgaagtttctgcaagtcttcctcttt |
2293855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 33 - 174
Target Start/End: Complemental strand, 2321311 - 2321169
Alignment:
| Q |
33 |
catttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgcccc-ggtgggtgacgcctcagcccttccaaaa |
131 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||||||||||| ||||||| || | ||||||||| |||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
2321311 |
catttttaggcaccaaataaccgttcaaaaccacatcctctttcaccgtgtgtgccaacacaaaatgcccctggtggatgacgcctcatcccttccaaaa |
2321212 |
T |
|
| Q |
132 |
tcacacactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
||| ||||| | |||| | || |||||||||| ||||||||| |
|
|
| T |
2321211 |
ccacgcacttcaaatatcgaagtttctgcaagttttcctcttt |
2321169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 33 - 174
Target Start/End: Complemental strand, 2327164 - 2327023
Alignment:
| Q |
33 |
catttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaat |
132 |
Q |
| |
|
|||||||||||| ||| ||||| || ||||||||||| || |||| ||||| ||||||||||| ||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
2327164 |
catttttaggcaccaaataaccattcaaaaccacatcatcgctcactgcatgaggcaacacaaaatgccctggtggatgacgcctcaacccttccaaaac |
2327065 |
T |
|
| Q |
133 |
cacacactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
||||||||| | ||| | || || ||||||||||||||||| |
|
|
| T |
2327064 |
cacacacttcaaataccgaagtttatgcaagtcttcctcttt |
2327023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 33 - 174
Target Start/End: Complemental strand, 2351185 - 2351044
Alignment:
| Q |
33 |
catttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaat |
132 |
Q |
| |
|
|||||||||||| ||| |||||||| |||| ||||||||| ||||||| || ||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2351185 |
catttttaggcaccaaataaccgttaaaaagcacatcctctgtcaccgcgtgtggcaacacattatgccccggtggatgacgcctcaacccttccaaaac |
2351086 |
T |
|
| Q |
133 |
cacacactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
|||||| || ||||| || |||||||| ||||||||||| |
|
|
| T |
2351085 |
cacacatttcagatacaaaagtttctgcaaatcttcctcttt |
2351044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 35 - 174
Target Start/End: Complemental strand, 2310325 - 2310186
Alignment:
| Q |
35 |
tttttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaatca |
134 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||| |||||||| || |||||| ||| | ||||| ||| |||||||||| ||||||||||| || |
|
|
| T |
2310325 |
tttttaggcaccaaataaccgtccaaaaccacatcctctttcaccgcgtgtggcaacggaaatttccccgatggatgacgcctcaacccttccaaaacca |
2310226 |
T |
|
| Q |
135 |
cacactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
||||||| | ||| || |||||||||||||||||||| |
|
|
| T |
2310225 |
cacacttcaaataccaaagtttctgcaagtcttcctcttt |
2310186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 37 - 174
Target Start/End: Complemental strand, 2330875 - 2330738
Alignment:
| Q |
37 |
tttaggcagcaagtaaccgttgaaaaccacatcctccttcaccgcatggggcaacacaaagtgccccggtgggtgacgcctcagcccttccaaaatcaca |
136 |
Q |
| |
|
|||||||| ||| ||||| || |||||||||||||| |||| || || |||||||| || ||||| ||||| |||||||||| ||||||||||| ||| |
|
|
| T |
2330875 |
tttaggcaccaaataaccattcaaaaccacatcctcgctcactgcgtgaggcaacacgaaatgccctggtggatgacgcctcaacccttccaaaaccacg |
2330776 |
T |
|
| Q |
137 |
cactttagatatggtaggttctgcaagtcttcctcttt |
174 |
Q |
| |
|
||||| | ||| | || || ||||||||||||||||| |
|
|
| T |
2330775 |
cacttcaaataccgaagtttatgcaagtcttcctcttt |
2330738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University