View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21563_low_5 (Length: 357)
Name: NF21563_low_5
Description: NF21563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21563_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 89 - 204
Target Start/End: Original strand, 20144143 - 20144258
Alignment:
| Q |
89 |
acaacaatggtaatcttttgcaaaaggggaaattgtgataatcgatcgccagatgtggtggtcggagataaatacagaggttggttgaaccgttgtttgg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20144143 |
acaacaatggtaatcttttgcaaaaggggaaattgtgataatcgatcgccagatgtggtggtcggagataaatacagaggttggttgaaccgttgtttgg |
20144242 |
T |
|
| Q |
189 |
ggttggaatgcaggac |
204 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20144243 |
ggttggaatgcaggac |
20144258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 266 - 343
Target Start/End: Original strand, 20144320 - 20144397
Alignment:
| Q |
266 |
aacatctgaaggaagatgtatctgggctagagatgttgataggaatggcttttggaagaatagtggaagttggtgatg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20144320 |
aacatctgaaggaagatgtatctgggctagagatgttgataggaatggcttttggaagaatagtggaagttggtgatg |
20144397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University