View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21564_high_11 (Length: 240)
Name: NF21564_high_11
Description: NF21564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21564_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 113 - 221
Target Start/End: Original strand, 28425698 - 28425805
Alignment:
| Q |
113 |
ccgctttgcagatctagcttctcatgctttgagctgccagcaacccatatattaactatagagtttacttgctttgattctcagctctagttattctcta |
212 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28425698 |
ccgctttgca-atctaacttctcatgttttgagctgccaacaacccatatattgactatagagtttacttgctttgattctcagctctagttattctcca |
28425796 |
T |
 |
| Q |
213 |
tcgctatat |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
28425797 |
tcgctatat |
28425805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 2955940 - 2955883
Alignment:
| Q |
112 |
accgctttgcagatctagcttctcatgctttgagctgccag--caacccatatattaa |
167 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
2955940 |
accgctttgcagatctaacttctcatgtcttgagctgccagtataacccatatattaa |
2955883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University