View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21564_high_4 (Length: 460)
Name: NF21564_high_4
Description: NF21564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21564_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 70 - 101
Target Start/End: Original strand, 4646575 - 4646606
Alignment:
| Q |
70 |
tttaatttcgatttgtgtatccttcagaaata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4646575 |
tttaatttcgatttgtgtatccttcagaaata |
4646606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 9 - 37
Target Start/End: Original strand, 4646514 - 4646542
Alignment:
| Q |
9 |
acatcatcaccatcctacttaattagcct |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4646514 |
acatcatcaccatcctacttaattagcct |
4646542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University