View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21564_low_5 (Length: 460)

Name: NF21564_low_5
Description: NF21564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21564_low_5
NF21564_low_5
[»] chr5 (2 HSPs)
chr5 (70-101)||(4646575-4646606)
chr5 (9-37)||(4646514-4646542)


Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 70 - 101
Target Start/End: Original strand, 4646575 - 4646606
Alignment:
70 tttaatttcgatttgtgtatccttcagaaata 101  Q
    ||||||||||||||||||||||||||||||||    
4646575 tttaatttcgatttgtgtatccttcagaaata 4646606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 9 - 37
Target Start/End: Original strand, 4646514 - 4646542
Alignment:
9 acatcatcaccatcctacttaattagcct 37  Q
    |||||||||||||||||||||||||||||    
4646514 acatcatcaccatcctacttaattagcct 4646542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University