View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21565_high_12 (Length: 217)

Name: NF21565_high_12
Description: NF21565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21565_high_12
NF21565_high_12
[»] chr4 (1 HSPs)
chr4 (27-204)||(2431076-2431267)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 27 - 204
Target Start/End: Original strand, 2431076 - 2431267
Alignment:
27 gatggcaatgtgcttctttgtgacctcatgataacgtgggta-------gcattaattttcaa-------agagtactagtaactctcaagtgataaaca 112  Q
    |||||||||||||||||||||||||||||||||||||| |||       ||||||||||||||       |||| || ||||||||||||||||||||||    
2431076 gatggcaatgtgcttctttgtgacctcatgataacgtgagtactgagtagcattaattttcaatttatgaagagcaccagtaactctcaagtgataaaca 2431175  T
113 cagaggctgaaaatccgagtggtaaaataaatcttctgaacaaaaaagtgaaaaacagtcatccatattggtagacataactatatgcaaag 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2431176 cagaggctgaaaatccgagtggtaaaataaatcttctgaacaaaaaagtgaaaaacagtcatccatattggtagacataactatatgcaaag 2431267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University