View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21565_high_12 (Length: 217)
Name: NF21565_high_12
Description: NF21565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21565_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 27 - 204
Target Start/End: Original strand, 2431076 - 2431267
Alignment:
| Q |
27 |
gatggcaatgtgcttctttgtgacctcatgataacgtgggta-------gcattaattttcaa-------agagtactagtaactctcaagtgataaaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
2431076 |
gatggcaatgtgcttctttgtgacctcatgataacgtgagtactgagtagcattaattttcaatttatgaagagcaccagtaactctcaagtgataaaca |
2431175 |
T |
 |
| Q |
113 |
cagaggctgaaaatccgagtggtaaaataaatcttctgaacaaaaaagtgaaaaacagtcatccatattggtagacataactatatgcaaag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431176 |
cagaggctgaaaatccgagtggtaaaataaatcttctgaacaaaaaagtgaaaaacagtcatccatattggtagacataactatatgcaaag |
2431267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University