View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21565_high_13 (Length: 201)
Name: NF21565_high_13
Description: NF21565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21565_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 39110084 - 39110254
Alignment:
| Q |
16 |
tgaagcaactgagtacattaagaaatgcttaggtggcggagaagatgatgcaatcatcttctgtggctcaggcacaactgcatccatcaaaagacttcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39110084 |
tgaagcaactgagtacattaagaaatgcttaggtggcggagaagatgatgcaatcatcttctgtggctcaggcacaactgcatccatcaaaagacttcaa |
39110183 |
T |
 |
| Q |
116 |
gaagtaatggtaattgcattgccttctattttgagggaaagtatgttgaatagccttagcaaagaagaaag |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39110184 |
gaagtaatggtaattgcagtgccttctattttgagggaaagtatgttgaatagccttagcaaagaagaaag |
39110254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 39100975 - 39101145
Alignment:
| Q |
16 |
tgaagcaactgagtacattaagaaatgcttaggtggcggagaagatgatgcaatcatcttctgtggctcaggcacaactgcatccatcaaaagacttcaa |
115 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| || ||||| |||||| |||| | || ||||| ||| |||| ||| ||||||| || |||||| |
|
|
| T |
39100975 |
tgaagcaaccaagtacattaaaaaatgcttaggtggtggggaagacgatgcactcatgctatgcggctcgggcgcaacggcagccatcaagaggcttcaa |
39101074 |
T |
 |
| Q |
116 |
gaagtaatggtaattgcattgccttctattttgagggaaagtatgttgaatagccttagcaaagaagaaag |
186 |
Q |
| |
|
|||||||||| ||| | | |||||||||||||| ||||| ||||||| |||||||| |||||||||| |
|
|
| T |
39101075 |
gaagtaatgggaatagttgtcccttctattttgagagaaagaatgttgaggtgccttagcgaagaagaaag |
39101145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University