View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21565_high_7 (Length: 254)
Name: NF21565_high_7
Description: NF21565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21565_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 39688370 - 39688617
Alignment:
| Q |
1 |
tcatgtttttgttcatcacggaagtgtatcttccacttactataactgtattacacaccccacataaaagtactgaaattgagcactcaattcaacccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39688370 |
tcatgtttttgttcatcacggaagtgtatcttccacttactataactgtattacacaccccacataaaagtactgaaattgagcactcaattcaacctaa |
39688469 |
T |
 |
| Q |
101 |
cccaccaacattgt-------tagttggcctctttttgatctgctatatacttgcaccgacacatccacatgttgtttcttgcattgacatcactccgtt |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39688470 |
cccaccaacattgttagttgctagttggcctctttttgatcttctatatacttgcaccgacacatccacatgttgtttcttacattgacatcactccgtt |
39688569 |
T |
 |
| Q |
194 |
gcttatggattagc---aggatttcccattcaaaataactaagttcat |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39688570 |
gcttatggattagcataaggatttcccattcaaaataactaagttcat |
39688617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University