View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21565_low_11 (Length: 242)
Name: NF21565_low_11
Description: NF21565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21565_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 7426466 - 7426230
Alignment:
| Q |
5 |
gagatattttgcctcactactcacggggccatgtaatcctcatctacagctttctctactatgattataaataaatga--ctctaatttcatcacagtca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7426466 |
gagatattttgcctcactactcacggggccatgtaatcctcatctacagctttctctactatgattataaataaatgactctctaatttcatcacagtca |
7426367 |
T |
|
| Q |
103 |
ccctctaatctcac-----aacaaagtcacaaaactcactagaaatggtagtagaattattgccacttcctaattgggttacnnnnnnnactacatttat |
197 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
7426366 |
ctctctaatctcacaccaaaacaaagtcacaaaactcactagaaatggtagtagaattattgccacttcctaattgggttactttttttacaacatttat |
7426267 |
T |
|
| Q |
198 |
catccttcttctctttacccgccgccgtcttcatctc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7426266 |
catccttcttctctttacccgccgccgtcttcgtctc |
7426230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University