View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21565_low_6 (Length: 334)
Name: NF21565_low_6
Description: NF21565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21565_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 13447886 - 13447615
Alignment:
| Q |
19 |
atcaatgaagtaacatttagctactctggcagatttaacatgaattttcgaatagtttaaacttaattgttttgattcaatttttggtgtgtacgtggct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447886 |
atcaatgaagtaacatttagctactctggcagatttaacatgaattttcgaatagttttc-cttaattgttttgattcaatttttggtgtgtacgtggct |
13447788 |
T |
|
| Q |
119 |
attctaacttcttaatgtgtttttgcatttattttaatttttcaactgcgagagtgtttatgtcaacacttctgtcagtctgacattgctgttgtttaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13447787 |
attctaacttcttaatgtgtttttgcatttattttaatttttcaactgcgagagtgtttatgtcaacacttctgtcagtctgacattgccgttgtttaca |
13447688 |
T |
|
| Q |
219 |
gtcgaatgaaatggaagaatcctgtaaagctggtttctgtactttaaatctctagattttgtgggatcctgtc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447687 |
gtcgaatgaaatggaagaatcctgtaaagctggttcctgtactttaaatctctagattttgtgggatcctgtc |
13447615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 100 - 163
Target Start/End: Complemental strand, 13454249 - 13454185
Alignment:
| Q |
100 |
ttttggtgtgtacgtggctattctaacttcttaatgtgtttttgcatttatttt-aatttttcaa |
163 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
13454249 |
ttttgttgtgtacgtggttcttctaacttcttaatgtgttttcgcatttattttcaatttttcaa |
13454185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University