View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21566_low_14 (Length: 251)
Name: NF21566_low_14
Description: NF21566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21566_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 162 - 227
Target Start/End: Original strand, 41345391 - 41345456
Alignment:
| Q |
162 |
atctttattcataatatatttgaattgaagtaattctgtatactaatcaatcttcaatgttgctga |
227 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
41345391 |
atctttctgcataatatatttgaattgaagaaatgcggtatactaatcaatcttcaatgttgctga |
41345456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 53
Target Start/End: Original strand, 41345252 - 41345281
Alignment:
| Q |
24 |
taagttttgaaatttcaacgaccatgatga |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41345252 |
taagttttgaaatttcaacgaccatgatga |
41345281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University