View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21566_low_16 (Length: 238)
Name: NF21566_low_16
Description: NF21566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21566_low_16 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 72 - 238
Target Start/End: Complemental strand, 26803718 - 26803552
Alignment:
| Q |
72 |
tacatgtatcggtgttgtgttgtgtcgaacaccaacacatgttagaggcagacatgctttccatcggaagtgtggattctccacaaacacacataaacta |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26803718 |
tacatgtatcggtgttgtgttgtgtcgaacaccaacacatgtaagagacagacatgctttccatcggaagtgtggattctccacaaacacacataaatta |
26803619 |
T |
 |
| Q |
172 |
ggtgtatgtttggatgagtttattgaacggatagttcggcaaaatcatggtgacactataatattgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
26803618 |
ggtgtatgtttggatgagtttattgaacggatagtttggaaaaatcatgatgacactataatattgt |
26803552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 26803800 - 26803748
Alignment:
| Q |
21 |
ttgatataaatattttacactaaacacaacatgacacatcaacaccggtgata |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
26803800 |
ttgatataaatattttacactaaacacaacatgacacatcgacaccagtgata |
26803748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University