View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21566_low_17 (Length: 216)
Name: NF21566_low_17
Description: NF21566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21566_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 3e-22; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 137 - 198
Target Start/End: Complemental strand, 3300323 - 3300262
Alignment:
| Q |
137 |
ttaatgcagttttctgcataacagacttttagagcagtatggtgaagctgtaaatatcacac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3300323 |
ttaatgcagttttctgcataacagacttttacagcagtatggtgaaactgtaaatatcacac |
3300262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 137 - 198
Target Start/End: Complemental strand, 3393216 - 3393155
Alignment:
| Q |
137 |
ttaatgcagttttctgcataacagacttttagagcagtatggtgaagctgtaaatatcacac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3393216 |
ttaatgcagttttctgcataacagacttttacagcagtatggtgaaactgtaaatatcacac |
3393155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 1162254 - 1162306
Alignment:
| Q |
146 |
ttttctgcataacagacttttagagcagtatggtgaagctgtaaatatcacac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1162254 |
ttttctgcataacagacttttagagcagtatggtgaagctgtaaatatcacac |
1162306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 65 - 145
Target Start/End: Complemental strand, 39727170 - 39727093
Alignment:
| Q |
65 |
attaaggtcaaaaacaagcattggatatttcacaagcaagagctttgcagattccatgataaaaatcatcacttaatgcag |
145 |
Q |
| |
|
||||||||||||||| | ||||||| ||||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39727170 |
attaaggtcaaaaaccaatattggatttttcataagcaagag-tttgcagattccatgat--aaatcatcacttaatgcag |
39727093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 879082 - 879043
Alignment:
| Q |
5 |
cttagatgttgattttatgtgtataagctacaaccgatgt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
879082 |
cttagatgttgattttatgtgtataagctacaaccgatgt |
879043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 145
Target Start/End: Complemental strand, 38988872 - 38988789
Alignment:
| Q |
61 |
cataattaaggtcaaaaacaagcattggatatttcacaagcaagagctttgcagattccatgataaaaatcatcacttaatgcag |
145 |
Q |
| |
|
|||||| |||||||||||| || ||||||||||||| || |||||| |||||| ||| ||| |||||||||||| ||| ||||| |
|
|
| T |
38988872 |
cataatgaaggtcaaaaaccagtattggatatttcataatcaagag-tttgcatatttcatagtaaaaatcatcagttattgcag |
38988789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 191
Target Start/End: Complemental strand, 40419810 - 40419763
Alignment:
| Q |
144 |
agttttctgcataacagacttttagagcagtatggtgaagctgtaaat |
191 |
Q |
| |
|
||||| |||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
40419810 |
agtttcctgcataacagactttcacagcagcatggtgaagctgtaaat |
40419763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 39
Target Start/End: Original strand, 12686046 - 12686081
Alignment:
| Q |
4 |
acttagatgttgattttatgtgtataagctacaacc |
39 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12686046 |
acttagatgttgattttatgggtataagctacaacc |
12686081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University