View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21566_low_9 (Length: 331)
Name: NF21566_low_9
Description: NF21566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21566_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 106 - 324
Target Start/End: Complemental strand, 31535962 - 31535747
Alignment:
| Q |
106 |
gcaattagccagtgaaaattgtgtcttatttgtggtgtaggccctggatgttcctctccaaactctaattaaagttactttggttggtggaagagaagac |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31535962 |
gcaattggccagtgaaaattgtgtcttatttgtggtgtaggccctggatgttcctctccaaactctaattaaagttactttggttggtggaagagaagac |
31535863 |
T |
|
| Q |
206 |
atnnnnnnnnctggggcctagttctggattaaaggattcatcatgtgcctattttgcactcacaattgacaattgcaagagaaagtttacactataataa |
305 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31535862 |
ataaaaaaaactggggcctagttctggattaaaggattcatcatgtgcctattttgcactcacaattgacaattgcaagagaaagtttacact---ataa |
31535766 |
T |
|
| Q |
306 |
tacatctctttttcatctc |
324 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31535765 |
tacatctctttttcatctc |
31535747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University