View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21567_high_5 (Length: 231)
Name: NF21567_high_5
Description: NF21567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21567_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 13877488 - 13877689
Alignment:
| Q |
21 |
cagttgtcctggctttcctccgaggaatcgaacaccattct---tccccttgcaaatagcatgtttatcaatataagtcgaatcaagcgaaacaaaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13877488 |
cagttgtcctggctttcctccgaggaattgaacaccattcttcttccccttgcaaatagcatgtttatgaatataagtcgaatcaagcgaaacaaaattg |
13877587 |
T |
|
| Q |
118 |
tataatttggtccatccatttaatttatccatgacccaaattctcattctgatcataggatggtaacactgcacaacataagcaagggaaccgttcatct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13877588 |
tataatttggtccatccatttaatttatccatgacccaaattctcattctgatcataggatggtaacactgcacaacataagcaagggaaccgttgatct |
13877687 |
T |
|
| Q |
218 |
ca |
219 |
Q |
| |
|
|| |
|
|
| T |
13877688 |
ca |
13877689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University