View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21567_low_6 (Length: 230)
Name: NF21567_low_6
Description: NF21567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21567_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 58 - 213
Target Start/End: Original strand, 26573572 - 26573728
Alignment:
| Q |
58 |
acacattattcaacaaaaaattctaccacaaagaaccaaatatcaaccattccctttccgagaggccacccttcaccc-ttatccccatctataactcaa |
156 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26573572 |
acacattattcaacaaaaaattataccacaaagaaccaaatatcaaccattccctttcccagaggccacccttcaccccttatccccatctataactcaa |
26573671 |
T |
|
| Q |
157 |
tcaattcaattgaagaagaacaaaaataagattgaacgaaggttgtctccattttat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26573672 |
tcaattcaattgaagaagaacaaaaataagattgaacgaaggttgtctccattttat |
26573728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University