View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21568_high_16 (Length: 220)
Name: NF21568_high_16
Description: NF21568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21568_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 22213252 - 22213453
Alignment:
| Q |
1 |
tgatgccgtaggtccaccagccggaacaggggagcttgctggagaaacagccactggagatggcggtgaaccagagggtgatggagtggttgtcgttggt |
100 |
Q |
| |
|
|||||||||||| || | | ||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22213252 |
tgatgccgtaggaccgctggtcggaacaggggagcttgctggaggaatagccactggagatggtggtgaaccagagggtgatggagtggttgtcgttggt |
22213351 |
T |
 |
| Q |
101 |
gacggtgaaggtggtgacaatccaccagcacttggtgaaggagaagattttggtggtgttcgtggagatataacaacaagggttaatttctgaccgtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22213352 |
gacggtgaaggtggtgacaatccaccagcacttggtgaaggagaagattt---tggtgttcgtggagatataacaacaagggttaatttctgaccgtttt |
22213448 |
T |
 |
| Q |
201 |
cacag |
205 |
Q |
| |
|
||||| |
|
|
| T |
22213449 |
cacag |
22213453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University